DICE & SLICE

DAY ONE

Wild type
dpy-13 (+)
Mutant
dpy-13 (–)
   

You will receive two plates of the nematode worm C.elegans.   One contains the wild type with the dpy-13 (+) gene. The other contains the mutant with the dpy-13 (–) gene.              

Identify the difference between the phenotype of the worm with the dpy-13 (+) gene and the phenotype of the worm with the dpy-13 (–) gene. Write this in the boxes on the right.


 

C. elegans L4 larva, showing the characteristic light patch on the lower side of the worm, a little to the left of the middle of the worm. The head of the worm is to the right. An egg is also visible in the bottom left corner of the picture.

Identifying L4s

You need to identify the L4 larval stage. These are smaller than the adult and are characterized by a light patch about half way along the body.   This is where the eggs will be released in the adult worm.

If you can't find any L4s, then transfer skinny worms instead.

The media

You will receive 3 plates containing nematode medium on which E. coli (OP50) are growing.   One of these plates is labeled L4440/IPTG.   This one has a special E. coli that contains the L4440 plasmid and an inducer (IPTG) in the nematode medium.   The other two have normal E. coli (OP50) and no inducer.

Label these three plates:
dpy-13 (+) /OP50 (L4440)
dpy-13 (+) /OP50
dpy-13 (–) /OP50

Put your initials and the date on all three plates.

Transfer five L4 stage wild type dpy-13 (+) worms in to the OP50 (L4440) plate and five to a regular OP 50 plate.  

Transfer five L4 stage mutant dpy-13 (–) worms to a regular OP50 plate.

You must sterilize the worm pick each time you transfer a different worm type or transfer the same worm type into a different plate. If you don't sterilize your pick, your experiment will fail!


W
O
R
M
S

Wild type
dpy-13 (+)
Wild type
dpy-13 (+)
Mutant
dpy-13 (–)
M
E
D
I
U
M
OP50 with
L4440 plasmid
OP50
OP 50

This should give you the plates with the following combinations of worms and mediums:


 

 

DAY TWO


What happens between Day One and Day Two?

The E. coli with the L4440 plasmid made dsRNA. This dsRNA was taken up by C. elegans.

C. elegans treats this dsRNA as if it were a virus infection and starts to dice & slice this and all matching RNAs.   This includes the mRNA transcribed from the worms own dpy-13 (+) gene.

The wild type gene dpy-13 (+) is therefore 'silenced'.

This is the phenomenon of RNA interference, or RNAi
 

The first generation, which were the worms you put in the plates on the first day have been removed. You should now have a mixture of two generations: the adult second generation (which reached maturity approximately 50 hours after being laid as eggs) and L1s (the first larval stage of the third generation , which are the offspring of the second generation).

You will receive three PCR tubes containing Proteinase K + buffer .

Label these tubes:

R for the dpy-13 (+) /OP50 (L4440)
W for the wild type dpy-13 (+) /OP50
M for the mutant dpy-13 (-) /(OP50)

For the following step, you must sterilize the worm pick between R, W and M.   If you don't, your experiment will fail!

Remove the adult dpy-13 (+) / OP50 worms, dpy-13 (+) /OP50 (L4440), worms and dpy-13 (-) /OP50 worms from their plates and put them in the three tubes R, W , M containing Proteinase K + buffer.

1. Spin these in a centrifuge for 5 seconds.
2. Put them on dry ice for 10 minutes
3. Heat them to 65 deg.C in a water bath for 1 hour.

After they have been in the water bath for 1 hour, the worm digests will be heated for 15 minutes to 95 deg. C to denature the Proteinase K enzyme, and the product will be put in the freezer overnight.

Preparing worms for PCR

 

DAY THREE


W
O
R
M
S

Wild type
dpy-13 (+)
Wild type
dpy-13 (+)
Mutant
dpy-13 (–)
M
E
D
I
U
M
OP50 with
L4440 plasmid
OP50
OP 50

T
Y
P
E

PCR

The worm digests are put into the PCR machine (thermal cycler).

At the end of the final PCR cycle, the amplified product is put in the freezer overnight.

Digitally photograph the worms.   Characterise and compare the worm types.

DNA amplification by PCR


 

DAY FOUR

DNA
Electrophoresis

Predicted outcome (what you expect to see) after DNA electrophoresis

 

Pipette the PCR product from the three tubes into three electrophoresis gel wells.

For the following step, you must sterilize the worm pick each time you transfer a different worm type or transfer the same worm type into a different plate. If you don't sterilize your pick, your experiment will fail!

Label three new plates: dpy-13 (+) RNAi /OP 50, dpy-13 (+) /OP 50, dpy-13 (-) /OP 50.   All these plates have regular OP 50.

Transfer five L4 worms from each of the three plates dpy-13 (+) /OP 50 (L4440), dpy-13 (+) /OP 50, dpy-13 (-) /OP 50, to the three new plates.

DNA electrophoresis

 

 

DAY FIVE

Observed outcome (what you actually saw) after DNA electrophoresis

 

For the following step, you must sterilize the worm pick each time you transfer a different worm type or transfer the same worm type into a different plate. If you don't sterilize your pick, your experiment will fail!

Remove and discard all the adult worms from the new plates.

Analyse the data from the electrophoresis gels, using the 'ladder' to figure out the lengths of the DNA fragments.

DAY SIX

Observe and digitally photograph the new adult worms that have appeared on the three OP 50 plates since Day Five, and compare them with the photographs you took of the adult worms on Day Three.

Explain the relationship between the electrophoresis results and the worm phenotypes under the different feeding conditions.

BLAST

Doing a BLAST search to find out the gene sequence for the dsRNA.

[BLAST = Basic Local Alignment Search Tool]

1. go to www.ncbi.nlm.nih.gov

2. select BLAST from the menu bar across the top of the page.

3. in the Nucleotide box, find

Nucleotide-nucleotide BLAST (blastn )

4. in the Search window, type in the following two sequences.   Double check you have the correct sequences.

These are the sites the primers recognise, not the actual base sequence of the primers.

AGTCGTCTTCTCCGTTATCG
GAGCAACGCATAAGGCAAAG

5. Go to Options and change All organisms to Caenorhabditis elegans.

6. Click on BLAST!   When a new window opens, click on Format! to get your results.   This may take a short while, but the results appear automatically.

The information is sent to the National Center for Biotechnology (NCBI) in Bethesda, Maryland.   BLAST then tries to match these two sequences to the millions of sequences that it has stored in its DNA database.

The search engine tries to match the sequence you typed in in several ways.   It tries both the forwards and backwards versions of the sequence.   It also tries to find a match using the sequence complementary to the sequence you typed in, in both its forwards and backwards versions.

For example if you type in AAAGGG, the search engine would look for AAAGGG, but also for the backwards sequence GGGAAA, and also for the corresponding complementary sequences TTTCCC and CCCTTT.

If any of these match it records a 'hit'.

How to interpret the results

BLAST tells you if there are any 'hits'. That is, whether it has found matches for the two primer recognition site sequences (or their complements, either forwards or backwards).

When it finds a 'hit' it presents this in the following way.


Query 1
A
A
A
G
G
G
  6 <       The sequence you are looking for
   
|
|
|
|
|
|
     
Sbjct 59
A
A
A
G
G
G
  65 <       What the search engine found

Here the letters are the same in the two rows, so this is a perfect match.   The numbers at the beginning and end of the top row identify the first and last base you typed in.    The number of the first base is 1. You typed in six bases, so the last number is 6.

The numbers on the bottom row identify the position of the hit in the genome, relative to a known starting point or origin.

To see the complete nucleotide sequence (including the primer recognition sites and the bit in between, click on the blue underlined link beginning with gi at the left end of the hit.

This gives the complete nucleotide base sequence. The base sequence shown is the + strand.   It also gives the amino acid sequence (using the one amino acid = one letter code) that would be the result of translating this base sequence.

Print out the base sequence and locate the two primer recognition sites on it.   Remember, the second primer recognition site is actually on the - strand, so to locate it on the + strand, it must first be converted to its complement and reversed.

For example, If the second primer recognises AACCGG, then the search engine will find a match with CCGGTT (the backwards complementary sequence).

The hit recorded on the screen however, is not shown as the backwards complementary sequence, but as the original forwards sequence.   Because it is written AAGGCC on the screen and not GGCCAA, it begins with the higher number (e.g. 62) and finishes with the lower number (e.g. 57).

You also want to know if a matching sequence is likely to occur by chance. The likelihood of any match being due to chance decreases as the sequence gets longer. When long sequences are involved, hits are much less likely to be due to chance. The number at the right end of the hit is the E-value. The lower the E-value, the more likely you are to have a real hit.

Do two hits for two primer recognition sites always mean the bit between them is the gene-of-interest?

This is likely if they are close together, and unlikely if they are very far apart, or on different chromosomes!   You can judge how far apart they are by calculating the distance between them.

The distance between the beginning of the first primer recognition site and the end of the second primer recognition site is calculated by subtracting the smallest number from the largest (e.g. 62 - 1), and adding 1.  

[A sequence of ten numbers spans 1 to 10.   But 10 - 1 = 9.   So the total length is 9 + 1 =10]


Length of
dpy-13 (+) gene
DNA version

Length of
dpy-13 (+) gene
mRNA version

   

Calculate gene sizes in bp. for the two shorter versions of the wild type gene, one based on DNA and one based on mRNA.

What is the difference in length between the DNA version and the mRNA?   Look at the amino acid sequence.   Note that it is identical for both versions.

Explain this in terms of what happens to mRNA in eukaryotes?   Identify the missing bits in the mRNA version.   What name would you give to these missing bits?


Looking for homologs in the human genome

1. Click on the link beginning with gi to get details of the gene you identified in the BLAST search.   Near the top left of the page find the Display menu.   Change the Display option to FASTA.   This gives you the complete sequence which you can cut and paste into the BLAST search window.

2. Copy the nucleotide sequence for the DPY-13 (-) mutant gene.

3. Go back to BLAST, and in a new window paste the complete sequence.

4. Go to Options and change All organisms to Homo sapiens.

5. Click on BLAST!   When the new window opens, click on Format! to get your results.   This may take a short while, but the results appear automatically.

6. Go to the second hit on the 'results of Blast' page and click on the blue underlined link

gi |14719826|ref|NM_000088.2| for Homo sapiens collagen, Type 1, alph

7. Find a named disease (syndrome) associated with this base sequence.

8. Google this name to find out more about the disease.   Describe its symptoms and figure out why it shares its symptoms with Dumpy 13 .

To locate this gene on the human genome map

Copy the reference number in the gi string.

Go to www.ncbi.nlm.nih.gov/mapview

Choose Homo sapiens (human) Build 36

Paste the reference number into Search for (delete the | at the end, if this is carried over)

Click on Find.

Chromosome
number:

 

 

This will identify the chromosome involved.   Note its number.

Click on the number beneath the chromosome to see the actual locus of the gene on the chromosome.  

Find the red line which identifies the locus of the gene.   Click on the blue rectangle next to the red line in the Genes_seq column to open the zoom window.

Click on Show 10M for maximum zoom.

Click on Show Sequence to see the complete sequence in place.

 

 

Brian Kahn     United Nations International School, New York.   bkahn@unis.org